Related Articles |
[Analysis of NF2 gene mutations in intraspinal Schwannomas].
Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2017 Oct 10;34(5):637-641
Authors: Liu S, Chen S, Zhang Okay, Lin J, Yang Q, Zhang Y, Liu S, Liu S
Summary
OBJECTIVE: To discover the correlation between intraspinal Schwannomas and mutations of the NF2 gene.
METHODS: Samples from 20 sufferers with sporadic intraspinal Schwannomas had been collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
RESULTS: 4 de novo frameshifting mutations of the NF2 gene had been found within the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The identical mutations weren’t discovered within the peripheral blood samples of the corresponding sufferers. The mutations have resulted in alteration of main construction of the protein. No vital distinction was discovered within the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between sufferers with or with out the mutations.
CONCLUSION: The occurrance and evolvement of sporadic intraspinal Schwannomas have an in depth relationship with mutations of the NF2 gene. The latters might lead to structural change and practical lack of the encoded protein and result in the illness phenotype within the sufferers.
PMID: 28981922 [PubMed – indexed for MEDLINE]