19 Harley St, London, W1G 9QJ, UK

[Analysis of NF2 gene mutations in intraspinal Schwannomas].

Related Articles

[Analysis of NF2 gene mutations in intraspinal Schwannomas].

Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2017 Oct 10;34(5):637-641

Authors: Liu S, Chen S, Zhang Okay, Lin J, Yang Q, Zhang Y, Liu S, Liu S

OBJECTIVE: To discover the correlation between intraspinal Schwannomas and mutations of the NF2 gene.
METHODS: Samples from 20 sufferers with sporadic intraspinal Schwannomas had been collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
RESULTS: 4 de novo frameshifting mutations of the NF2 gene had been found within the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The identical mutations weren’t discovered within the peripheral blood samples of the corresponding sufferers. The mutations have resulted in alteration of main construction of the protein. No vital distinction was discovered within the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between sufferers with or with out the mutations.
CONCLUSION: The occurrance and evolvement of sporadic intraspinal Schwannomas have an in depth relationship with mutations of the NF2 gene. The latters might lead to structural change and practical lack of the encoded protein and result in the illness phenotype within the sufferers.

PMID: 28981922 [PubMed – indexed for MEDLINE]

Truspilot Reviews

In February 2021 I felt excoriating pain in my lower back. I was unable to stand up straight with my right leg having spasms occurring every hour. The sciatic pain accelerated within days I was bed bound to the point I needed help with basic daily activities such as making a cup of tea. I read the reviews about Dr Akmal, which I found beneficial and decided to book a consultation to see him. I was booked for a Consultation with Dr Akaml as well as an MRI scan & blood tests. I was pleasantly surprised to find out that I would get the results on the same day with the treatment options. Dr Akmal was very friendly he discussed the MRI scan with me that showed disc L4-L5 impinging the nerve, he suggested two options. One was the laser treatment to shrink the disc or the second the option was a discectomy. This would be a day procedure with no overnight stay. At no point did I feel pressured to decide on the procedures. Dr Akmal is incredibly knowledgeable this was evident through his years of experience with spinal procedures, I was 100% that the best option would be the discectomy and the best Surgeon was Dr Akmal. I was so impressed with the service and care that was offered at the clinic it was no less than first class to be honest, with no waiting time at all. On the day of the procedure I was in a private room, a lovely healthcare assistant was there to help me get into the hospital gown. Every staff member was ever so kind, they all made me feel at ease. Once I woke up I felt no sciatic pain at all which was an amazing feeling, an emotional moment to finally be rid of that burning sensation. Of course, there was some slight discomfort where the procedure had taken place. After surgery, I was able to stand on my two feet as well as being able to walk without any discomfort. Finally making my own cooked breakfast was a heavenly feeling! I can say with complete confidence that I trust Dr Akmal he is no doubt, on top of his field, a great human being who I’m so grateful to have met. If you want your life back I would highly recommend you book yourself in for a consultation with Dr Akmal, he is worth every single penny! Thank you Dr Akmal!
Good treatment, uncomplciated, great solution,
Sam Sahota
Sam Sahota
My personal experience of The London Spine Unit in Harley Street London and the whole team of surgeon Mo Akmal written two weeks after my Surgery . It’s been an absolutely amazing experience. I am a 58 year old male . Many years ago I was breaking some concrete with a very large sledgehammer that’s where all my problems started. During these many years I have undergone Facet joint injections, many appointments with Osteopaths,Chiropractors,Acupuncture,Massages etc etc the list is endless.They would be helpful for a few days and then the pain in my back and weakness in my legs would return. 2019 had Mri of lumbar area showed disc bulge trapping nerves in l4/5 areas I underwent an open surgery on Nhs to cut away part of the disc that was causing the problem.I was in hospital for 5 days and recovery took many months, Then the pain returned!!I then decided to live with the unbearable pain as I couldn’t go through all that again, I was recommended to Mo Akmal, he arranged a much clearer Mri within two hours he took a look and identified the problem the following week after my pre op assessment my keyhole surgery was done within 2 hours , immediately I was pain free I noticed immediately the pain free sensation I was very happy with the outcome , it was so simple , I could walk painfree. I came in a taxi in the morning and took a taxi back home in the evening . Mo akmal Is a very professional surgeon it was like talking to a friend no rush at all , didn’t even seem like a surgery, Member of his team calls me three times a week to see how I’m getting on. Now I don’t even think about my back as I have zero pain , I sleep well, I feel much better from within, I have no hesitation in recommending Mo Akmal . I am a person that does so much research into things like this as I know the risks aswell as the benefits,I jumped at the opportunity that was given to me for this keyhole surgery. I did not tell anyone of my friends as they really did not know the pain I was in and if I had told them I know they would of discouraged me of going ahead. 2 weeks later I feel totally pain free. If in any doubt I do not mind Mo giving my email to anyone as long as I can help them out of pain .i was always told use hot and cold packs on your back , it didn’t help much mine was a much more deep rooted problem that need proper intervention I have learnt over the years that very seldom will a therapist ever tell you to get an MRI to see exactly what is going on inside your body it’s left to your own judgement, no amount of alternative therapy would of actually helped my problem if I wanted to get to the root of the problem..It’s your choice to go ahead with treatment or not BUT atleast you will know and have a better understanding of exactly what is causing your problem. I would say Don’t suffer in silence do something about it like I did .
Mrs Michelle Hunter
Mrs Michelle Hunter
I would highly recommend Mr Mo Akmal and his team at the London Spine Unit. I have had issues with my lumbar spine for over 20 years and have struggled to find someone who could help. My situation was complicated by a separate neurological diagnosis 7 years ago. Mr Akmal listened to my medical history and offered informed and honest advice, taking a holistic view based on his extensive experience and listening to my opinion with an open mind. I have had 2 minimally invasive procedures at the London Spine Unit during the Covid pandemic. I felt very safe and well looked after on both occasions. The results were great, they allowed me to finally exercise without pain & weakness and to play with my 2yr old! (Which was very important with nursery closures in Scotland!). I still have a way to go but I feel like I have finally found someone who genuinely cares and understands, and I am no longer alone with my health journey. Thank-you Mr Akmal and your amazing team!!
Lee Burnside
Lee Burnside
Top notch service great staff and a fantastic after care support. After having partial disc removed i woke up to zero pain and could walk upright no problem well worth paying for the private treatment.
I had been suffering with a trapped nerve in my back for 18 months which meant I could only stand for about an hour and I couldn’t sit in a chair. I was spending 70% of my day lying down. I had been off work all this time on universal credit (£80 a week). Four different doctors and two consultants said it was a muscle problem. NHS finally agreed to give me an MRI which clearly showed my L5/S1 disc was badly worn, the L5 vertebrae was arthritic and the vertebrae were rubbing together but still they told me it was a muscle problem. One consultant told me I was imagining my leg pain and said to buy a tennis ball and massage my muscle with it by pushing it into my back! I then went to a private hospital in Aberdeen, the consultant there was very arrogant and told me fusing vertebrae and replacing discs didn’t work. He said my problem would go away after a couple of years! This is when I found Mr Akmal! I did an internet search and while I was reading about The London Spine Clinic one of Mr Akmal’s team asked me via web chat if they could help. I briefly explained my back problem and arranged an appointment over the phone for the next day. I uploaded my MRI and Mr Akmal phoned me with his diagnosis. He gave me a fair and honest opinion and said I could take his diagnosis and get treatment elsewhere as I live 700 miles away. Mr Akmal said there was nothing left of my disc and needed an operation. After more fobbing off by the NHS I decided to get the surgery done by Mr Akmal. I flew from Orkney to London on my own on the Sunday, had the operation on the Monday. I went back to my accommodation 2.5 hours after the operation in a taxi. I went back for a check up by Mr Akmal on the Tuesday and flew home to Orkney on the Wednesday. The operation was for: Posterior Lumbar Decompression + Instrumented Fusion. I am so glad I chose Mr Akmal and The London Spine Clinic for this procedure. My whole experience from start to finish was amazing. All the staff were really friendly and helpful. Mr Akmal’s skill, experience and passion for helping people really shines through. The follow up appointments have been excellent. The whole experience was so laid back it doesn’t feel like I had major back surgery 18 days ago. My pain has completely gone. I walked 3 miles for the first time in 2 years the other day. I cannot put into words how this has changed my life! If you have back pain I cannot recommend Mr Akmal highly enough, he will give you an honest opinion and offer the best solution for your problem.
Tash Dean
Tash Dean
I have had back problems for years after an injury at work when I was in my early 20s. I have seen multiple doctors, osteopaths, chiropractors and even other surgeons but for 8 years I struggled on with no improvement, if anything the condition got worse. At times I would often have to stay in bed for a week or take a lot of pain killers to get through a working day when things would flare up. Dr Akmal and his team were patient and really listened to my history and condition. He was quick to see the problem from an MRI and suggested different options for my recovery starting with the least invasive with the hope this would work. Sadly we tried a few things which didnt work but I am glad we went through the process of ruling out lesser procedures first and also physiotherapy. In the end we made the decision that I should have a L4/L5 lumbar spinal fusion as a day case. I was very nervous about this as I really wanted to avoid surgery however Dr Akmal and the team talked me through everything and reassured me that the benefits could really be amazing and I have to say they were really right. It took a few weeks to let everything heal but within 2 months I could already feel the benefits and now after 5 months from the surgery I feel like a new person, I have my full mobility back, can still comfortably, lift things and move and exercise in a way that I haven’t been able to in years and all without the fear of further hurting myself. I really cant praise Dr Akmal and the team enough. He is patient, kind and understanding and really put me at ease and answered any questions and concerns I had. I would recommend anyone with back issues to consult with him as it really could change your life and I am so grateful.
Premier Cars
Premier Cars
My wife had been in severe back and leg pain for almost 3 months, we had tried going to A&E a few times to get help but all they did was keep giving her stronger pain killers and requested a scan which took 2 months to come through and was dated for a further month she was crying in pain and I had to literally carry her to the toilet and had to bath her I was left with limited choices I took her to Dubai for a quicker privately funded a MRI scan which showed her disc impairment and was advised laser back therapy treatment which did not help we came back to the uk, by this time she was in a wheelchair and completely reliant on myself which caused a lot of emotional stress along with having to see her cry all the time we then had some treatment in Sheffield which again did not help at this point I was sure she needed back surgery and the NHS wasn’t willing to help until they said she reached the peak of this problem and was told to dial 999 if her water works had stopped which I found even more worrying and pathetic I didn’t want to see my wife struggle or cry anymore so I searched up the best back specialists in uk and Mr Mo Akmal from Harley Street Hospital (HSH) came up he was available for an appointment the next day when we attended he reassured us by looking at her MRI scan report that she needed an operation but of course there was other cheaper treatments available to us to try before so I made it clear to DR Mo Akmal that money was no issue and we need the best treatment which was going to be having back surgery we was called back to HSH for an operation 2 days later DR Mo Akmal was amazing and provided the best reassurance and said “ she’s in a wheelchair but she will walk back out of here” I was jumping for joy my wife went in on a wheelchair and Alhamdulillah walked back out on her own 2 feet I just can’t thank DR MO AKMAL and his team at Harley Street Hospital the best place for treatment and the best care from the moment you enter their front door till you walk out 10/10
Devan B
Devan B
I was seen by Mr Akmal for a L4/L5 discectomy. One of the biggest hurdles with any medical treatment is being comfortable and surrendering to the process. Mr Akmal and his team are consummate professionals with a very human bed side manner and give you the reassurance you need. I initially reached out to Mr Akmal via email and within a few hours he responded and an initial consultation was booked. The team is welcoming from front desk through to admin, theatre staff and all support doctors. This is a reflection of Mr Akmal himself. Everyone had plenty of time and no question was too trivial. I never felt rushed in my pre operation appointments when Mr Akmal discussed all options and we jointly agreed on my discectomy. Given my pain level surgery was planned and I was booked within days of my initial consultation. I very quickly came to realise that I was not just a number as in no time everyone knew my name. The day of the procedure I had a full briefing by the theatre staff who kept me updated on the time that I would be taken to theatre, with a pre op visit by Mr Akmal. The patient pods were very comfortable and clean. I walked to theatre and again the staff alleviated any anxiety I felt. Mr Akmal was already in theatre. Post op the recovery team were wonderful ensuring that I was comfortable and provided a light refreshment. Mr Akmal came to see me two hours post op and I walked with him - pain free! The discharge was seamless and for the first few days the team called to check on me. Mr Akmal reviewed me in clinic two weeks post op and again had plenty of time for all my questions. I am now 5 weeks post op and healing well. The London Spine Unit delivered on all my expectations. A very seamless team and service. A big thanks to Mr Akmal, Dr Lok, Rola and the whole team for looking after me.
Juan C H
Juan C H
I was checking for recommendations on the best spine clinics in London, and the London Spine Unit came up. Without a doubt it is one of the best or I would say the best Spine Unit in London or even in the UK. I had the luck to be in the care of Dr Mo Akmal, which tried to find the best solution for my back issues and he did, I had surgery 2 weeks ago and it totally fixed my spine issue. I am pain free now and I can finally have a normal life with no pain at all, of course the care of the nurses and staff of the clinic very professional and very warm. Thank you for everything, I can't thank you enough for all the help given by the whole personal in the clinic.

London Spine Unit Harley Street Hospital A Focus on High Quality specialised Care

We are a specialist Private Hospital based on Harley Street, London UK The Harley Street Hospital, Day Surgery Hospital

We provide exclusive health services for individuals seeking Advanced medical, non-surgical or minimally invasive treatments. We are covered by All Insurance Companies apart from AXA PPP

Mo Akmal

Our Medical Director and Lead Spinal Surgeon Mr Mo Akmal MD is a world renowned Spine Specialist Consultant with over 20 years of experience. He and his team have developed revolutionary techniques to perform all types of Spinal Surgery as a Day Case procedure without traditional General Anaesthetic.

We are constantly improving our techniques for treatment and improving facilities for our patients.

Book your Appointment Now Check out our Reviews Check out our Patient Videos Check our Mr Akmal's Profile


What our patients say ...

Analysis of NF2 gene mutations in intraspinal Schwannomas | West london physio

Revolutionary Keyhole surgical technique to vaporise bulging discs

Laser Disc Surgery can be performed under local anaesthetic as a day case at our centre on the prestigious Harley Street.

Initial Consultation

with Consultant Spine Surgeon
£ 250
  • No Waiting Times
  • Top NHS affiliated Consultant
  • Includes Clinical Review and Report
  • Multidisciplinary discussion
  • Review of Previous Scans and Reports

Follow up Consultation

any appointment after initial consultation
£ 180
  • Top NHS affiliated Consultant
  • Includes Clinical Review and Report
  • Multidisciplinary discussion

MRI Scan

any Single Region
£ 700
  • No waiting times
  • Includes Full Radiologist Report
  • Open or Closed MRI scan types
  • Copy of Scan on CD

Website Offer

Pre-Booked Online
£ 700
  • Initial Consultation
  • MRI Scan (Single Region)
  • Follow Up consultation
  • One Stop Visit
  • Full Medical and MRI scan Report
  • Copy of scan on CD

If you have any emergency Doctor’s need, simply call our 24 hour emergency

Your personal case manager will ensure that you receive the best possible care.

Call Now 

+44 844 589 2020
+44 203 973 8810